snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD1C
sequence
CTGAGCTGAGGATGATTTAAAGTTATCCCTGTCTGAAATGGTATCTTTTGTGAGGAGGT
CTGACTTGCTGAGGCTCAG
  Box motif
  Complementary to target RNA
length 78
organism Homo_sapiens
snoRNA name SNORD1C
alias snR38C
chromosome ⁄ contig 17
locus ⁄ host gene BC042949
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site 28S:G4362
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved