snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA38B
sequence
CCCTCCTACAAAGGCATGTCTATAGTTCCTTGTCTTTGGACATGTAAGAATTGGAGGCA
AAGAAATGTGGACTTGGAGAAATCTGGGGCCAGCTTGCTCTCCGCAGGCTCAAGATCAAC
CATCCCACATAG
  Box motif
  Complementary to target RNA
length 131
organism Homo_sapiens
snoRNA name SNORA38B
alias ACA38B
chromosome ⁄ contig 17
locus ⁄ host gene NOL11
organization Intronic
target RNA Unknown
modification type H/ACA
modification site
accession no AM413012
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved