snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD3@L46
sequence
AAGACTATATTTTGAGGGATAATTTCTATAGTGTGTTTCTCGAGGAGTATATCTGAACG
TGTAGAACGCTGGAAACCGCGAGAGGGAGATATTTGTGTTCTCTCACGAGTGGGATAGCA
GTGTTTGGTGTTGCGTTATTCTAACTGCTGTTTGCTGTTGGTGACCGTTCTTCTCTAGAG
AAGGCAGTCTGAGTAG
  Box motif
  Complementary to target RNA
length 195
organism Homo_sapiens
snoRNA name SNORD3@L46
alias
chromosome ⁄ contig 17
locus ⁄ host gene TEX14
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved