snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA21
sequence
CCCCTTTTAAAAGCACTCAATGGGCCTGTGGCTAATGACCTATTGAGCCGTCAAGAAAG
GGGAGAGTGAAAACATCGCTTTTGGGTGAAGTGGCAACATGTGTTGTTTGCTTCAATCGG
TGGTGTGACAAGG
  Box motif
  Complementary to target RNA
length 132
organism Homo_sapiens
snoRNA name SNORA21
alias ACA21
chromosome ⁄ contig 17
locus ⁄ host gene RPL23
organization Intronic
target RNA 28S rRNA
modification type H/ACA
modification site 28S:U4401,28S:U4470
accession no AJ609436 NT_010783
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved