snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD42A
sequence
AATGATGGAAAAATCATTATTGGAAAAGAATGACATGAACAAAGGAACCACTGAAGTG
  Box motif
  Complementary to target RNA
length 58
organism Homo_sapiens
snoRNA name SNORD42A
alias U42A
chromosome ⁄ contig 17
locus ⁄ host gene RPL23A
organization Intronic
target RNA 18S rRNA
modification type C/D
modification site 18S:U116
accession no NR_000014,NT_010799
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved