snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD65
sequence
AAATGATGAAATCACCCAAAATAGCTGGAATTACCGGCAGATTGTGTAGTGGTGAACCT
ATGGTTTTCTGAAG
  Box motif
  Complementary to target RNA
length 73
organism Homo_sapiens
snoRNA name SNORD65
alias HBII-135
chromosome ⁄ contig 17
locus ⁄ host gene C17orf45
organization Intronic
target RNA 18S rRNA
modification type C/D
modification site 18S:U627
accession no NR_003054,NT_010718
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved