snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD118
sequence
ATCGTCAGGTGGGATAATCCTTACCTGTTCCTCCTCCGGAGGGCAGATTAGAACATGAT
GATTGGAGATGCATGAAACGTGATTAACGTCTCTGCGTAATCAGGACTTGCAACACCCTG
ATTGCTCCTGTCTGATT
  Box motif
  Complementary to target RNA
length 136
organism Homo_sapiens
snoRNA name SNORD118
alias U8
chromosome ⁄ contig 17
locus ⁄ host gene
organization Intronic
target RNA
modification type C/D
modification site Processing
accession no NT_010718
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved