snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA67
sequence
ATCCAAGGTGATTCCCTCTCCAAGGGGACATCAGTGCCTCTCAGGAAAGTAGCAGCTTG
GAATAGAATCTGGCATGCCTAAGGCCTTTGGGGAACTGGGATGCTTATTTCCTCTGCCTT
CCTTGGCTGCCCACATGG
  Box motif
  Complementary to target RNA
length 137
organism Homo_sapiens
snoRNA name SNORA67
alias U67
chromosome ⁄ contig 17
locus ⁄ host gene EIF4A1
organization Intronic
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U1445
accession no Y11161 NT_010718
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved