snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA48
sequence
TGTCCCTGACCTGGGTAGAGTGGCATCTGGTTGGTGATGCCCATCTCATATCAGCCAGG
GACAAAGCAACTCCTTGTTCATCCCAGCTTGGCTTTTGATCCGTGCCCATGCCTGGTTCA
TGCCTTGGACACATAG
  Box motif
  Complementary to target RNA
length 135
organism Homo_sapiens
snoRNA name SNORA48
alias ACA48
chromosome ⁄ contig 17
locus ⁄ host gene EIF4A1
organization Intronic
target RNA 28S rRNA
modification type H/ACA
modification site 28S:U3797
accession no AJ609447 NT_010718
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved