snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD91A
sequence
TAGAGAAGTCAATGATGGTTTTATTCATATCGTCTGAACCTGTCTGAAGCATCTCAGTG
ATGCAATCTCTGTGTGGTTCTGAGACTTCTCCA
  Box motif
  Complementary to target RNA
length 92
organism Homo_sapiens
snoRNA name SNORD91A
alias HBII-296A
chromosome ⁄ contig 17
locus ⁄ host gene TSR1
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site 28S:G4588
accession no NR_003072,NT_010718
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved