snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA49
sequence
CTTCCTCAGCCTTACTCCAGGGACTTTTTGTTGCCTGTAAAGTGCTCTGGCATTGCCTG
AGGATAGATGAGAAAGCACATATCCCTCCCCAGTAAGACGCTGTTTTCTTTTGGGGCCTA
CAAGTTGAGCTGACAGTA
  Box motif
  Complementary to target RNA
length 137
organism Homo_sapiens
snoRNA name SNORA49
alias ACA49
chromosome ⁄ contig 12
locus ⁄ host gene EP400
organization Intronic
target RNA Unknown
modification type H/ACA
modification site
accession no NR_002979 NT_009755
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved