snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD50BL1
sequence
AATCAATGATGAAACCTATCCCAAAGCTGATGACCTGAAGAAAAATACGTACAGATTCA
GCTTCTGAGAT
  Box motif
  Complementary to target RNA
length 70
organism Homo_sapiens
snoRNA name SNORD50BL1
alias
chromosome ⁄ contig 12
locus ⁄ host gene VPS29
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved