snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA53
sequence
AACATGCTTCCTTAGATCCACCTTTGTGGATGAATCTTGAACTGAGTTCCACTTGTAAA
CTTCTTGTTTCTTGTGGTTCCAGTAGTCAAAGAAACATCCAGCAACTTTTTTGGTTGTAT
AGTCAAAGGTGCTTGAGTCATTGGCATGTAAGAGAAATATACCTGCATGTTAGTCTAACG
TTCTGATAGAAATGACATGCATTTATGCTGCCATTTGTTACTATCAGGACTCGACTCGTG
TGCGGACATTT
  Box motif
  Complementary to target RNA
length 250
organism Homo_sapiens
snoRNA name SNORA53
alias ACA53
chromosome ⁄ contig 12
locus ⁄ host gene
organization Intronic
target RNA
modification type H/ACA
modification site
accession no NR_003015 NT_029419
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved