snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD59B
sequence
CCTCACTGATGAGTACGTTCTGACTTTCGTTCTTCTGAGTTTGCTGAAGCCAGATGCAA
TTTCTGAGAAGG
  Box motif
  Complementary to target RNA
length 71
organism Homo_sapiens
snoRNA name SNORD59B
alias U59B
chromosome ⁄ contig 12
locus ⁄ host gene ATP5B
organization Intronic
target RNA 18S rRNA
modification type C/D
modification site 18S:A1031
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved