snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA2A
sequence
TAGGCCCTGAATCAAGACCAATGGTTTGCTGTAGCTGTTGGTTTCAAACAGGAGCTAAG
AGTGATGTCTTCCTTGTGGTCTGTTGGCTATTCAGTATTCCAGTGCGAATTGCCAATTCA
GTTGGAAGAAACATAG
  Box motif
  Complementary to target RNA
length 135
organism Homo_sapiens
snoRNA name SNORA2A
alias ACA2a
chromosome ⁄ contig 12
locus ⁄ host gene C12orf41
organization Intronic
target RNA 28S rRNA
modification type H/ACA
modification site 28S:U4263,28S:U4282
accession no AJ609426 NT_029419
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved