snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD43
sequence
CACAGATGATGAACTTATTGACGGGCGGACAGAAACTGTGTGCTGATTGTCACGTTCTG
ATT
  Box motif
  Complementary to target RNA
length 62
organism Homo_sapiens
snoRNA name SNORD43
alias U43
chromosome ⁄ contig 22
locus ⁄ host gene RPL3
organization Intronic
target RNA 18S rRNA
modification type C/D
modification site 18S:C1703
accession no X96642,NT_011520
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved