snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD83A
sequence
GCTGTTCGTTGATGAGGCTCAGAGTGAGCGCTGGGTACAGCGCCCGAATCGGACAGTGT
AGAACCATTCTCTACTGCCTTCCTTCTGAGAACAGC
  Box motif
  Complementary to target RNA
length 95
organism Homo_sapiens
snoRNA name SNORD83A
alias U83A
chromosome ⁄ contig 22
locus ⁄ host gene RPL3
organization Intronic
target RNA Unknown
modification type C/D
modification site
accession no NR_000027,NT_011520
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved