snOPY snoRNA Orthological Gene Database
Homo_sapiens Z73421.1
sequence
ATGAAGTGATTGTTTCACCCCTTTATAGGTCCGTGTTTCTGACTCACTTTAATAGGACT
GAAACTCGTGATTGT
  Box motif
  Complementary to target RNA
length 74
organism Homo_sapiens
snoRNA name Z73421.1
alias
chromosome ⁄ contig 22
locus ⁄ host gene LARGE
organization Intronic
target RNA
modification type unknown
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved