snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA14B
sequence
CTGCATTCTTAAACCCTCTTGGTAGCTTCGTTCTAAGTGCTTCCAAGATATGAGTGAAT
GCTATAGAAATTGCAGGGGAGTCCAAAGGGCTGCGCTTCTCCCGTGGCTCAGTCTTATTT
CATACCTGCGACATCT
  Box motif
  Complementary to target RNA
length 135
organism Homo_sapiens
snoRNA name SNORA14B
alias ACA14b
chromosome ⁄ contig 1
locus ⁄ host gene TOMM20
organization Intronic
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U966
accession no AJ609457
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved