snOPY snoRNA Orthological Gene Database
Homo_sapiens BX571818.3
sequence
TGTCAAAAATTCCCCAATCCTATTTCTGACACTTCATATGAAAGCTGCATGTGCAGTCT
TATTATTATTTTGCAAGCCTGGGGCTT
  Box motif
  Complementary to target RNA
length 86
organism Homo_sapiens
snoRNA name BX571818.3
alias
chromosome ⁄ contig 1
locus ⁄ host gene C1orf186
organization Intronic
target RNA
modification type unknown
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved