snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA77
sequence
GCAGACTCACTATGCACCTGACTGTACTTCCAGGCAGGTGCTTTTTCTGTCTGCCAGAG
AAACATTCCAGGGTGCTGTGGCTGCCTCACCTATCCAGGGCGATGCAGCTCCCTGGGGAC
ACAGGT
  Box motif
  Complementary to target RNA
length 125
organism Homo_sapiens
snoRNA name SNORA77
alias ACA63
chromosome ⁄ contig 1
locus ⁄ host gene ATP2B4
organization Intronic
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U814
accession no NR_003019, NT_004487
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved