snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA42
sequence
TGGTAATGGATTTATGGTGGGTCCTTCTCTGTGGGCCTCTCATAGTGTACCCATGCCAT
AGCAAATGGCAGCCTCGAACCATTGCCCAGTCCCCTTACCTGTGGGCTGTGAGCACTGAA
GGGGGTTGCACAGTG
  Box motif
  Complementary to target RNA
length 134
organism Homo_sapiens
snoRNA name SNORA42
alias ACA42
chromosome ⁄ contig 1
locus ⁄ host gene KIAA0907
organization Intronic
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U572,18S:U109
accession no AJ609465 NT_004487
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved