snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA66
sequence
GTGCAAACTCGATCACTAGCTCTGCGTGATGTGGCAGAAGCGAAGGGAACCAGGTTTGC
AAAAGTAACTGTGGTGATGGAAATGTGTTAGCCTCAGACACTACTGAGGTGGTTCTTTCT
ATCCTAGTACAGTC
  Box motif
  Complementary to target RNA
length 133
organism Homo_sapiens
snoRNA name SNORA66
alias U66
chromosome ⁄ contig 1
locus ⁄ host gene RPL5
organization Intronic
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U119
accession no Y11160 NT_032977
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved