snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD45B
sequence
GGTCAATGATGTAATGGCATGTATTAGCTGAATCTAAAGTTGATGTGAGTTCTAAAATT
ACACTGAGACCTT
  Box motif
  Complementary to target RNA
length 72
organism Homo_sapiens
snoRNA name SNORD45B
alias U45B
chromosome ⁄ contig 1
locus ⁄ host gene RABGGTB
organization Intronic
target RNA 18S rRNA
modification type C/D
modification site 18S:U172
accession no X96645
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved