snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD45C
sequence
GGTCAATGATGAGTTGGCATGTATTCTGAATCTAAAGTTGATTATTACTACTTTAGCTC
TAGAATTACTCTGAGACCTG
  Box motif
  Complementary to target RNA
length 79
organism Homo_sapiens
snoRNA name SNORD45C
alias U45C
chromosome ⁄ contig 1
locus ⁄ host gene RABGGTB
organization Intronic
target RNA 18S rRNA
modification type C/D
modification site 18S:A159
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved