snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA63
sequence
AAGCAGGATTCAGACTACAATATAGCTGTTAAGTGCTGTATTGTCATTCCCCCTGCTCA
AATTAAAGTTGTTTCTTAACTATACCCATCTGCTATTCTGTAGCAGCCAGGGATGCTTGG
TCACATACAT
  Box motif
  Complementary to target RNA
length 129
organism Homo_sapiens
snoRNA name SNORA63
alias
chromosome ⁄ contig 1
locus ⁄ host gene C1orf102
organization Intronic
target RNA 28S rRNA
modification type H/ACA
modification site 28S:U4390
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved