snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA44
sequence
CAGCATGTTTCCAAGGGCTGTGGCTGGTCATAGCCATGGGATCTCCAACTGCATGCAAG
AGCAACCTGGAAAGACTTTGACAGCGCAGGTCAGTACAATACCTGCAAGCTGCCACTCAG
CTTTCCTATAATG
  Box motif
  Complementary to target RNA
length 132
organism Homo_sapiens
snoRNA name SNORA44
alias ACA44
chromosome ⁄ contig 1
locus ⁄ host gene C1orf79
organization Intronic
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U686,18S:U822
accession no AJ609466 NT_004610
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved