snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA61
sequence
ATCCTCCTGATCCCTTTCCCATCGGATCTGAACACTGGTCTTGGTGGTCGTAAAAGGAG
GAAAAGTAATAGTGAAGCTGGCCTAAATGTTGTAATCTGGTATATGGCATGTGGGCTAGT
TTCAGACAGGT
  Box motif
  Complementary to target RNA
length 130
organism Homo_sapiens
snoRNA name SNORA61
alias ACA61
chromosome ⁄ contig 1
locus ⁄ host gene C1orf79
organization Intronic
target RNA 28S rRNA
modification type H/ACA
modification site 28S:U2495
accession no AJ609451 NT_004610
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved