snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA56
sequence
CGGCAGACAGTTATCCCTTTCTAGTCTGGCTCGTGGGACTCTAGAGGGAGTCAGTCTGC
AACAGTAAGTGGTGAGTTCTTCTGTCCAGCGTCAGTATTTTGATGGTGGCTTTAGACTTG
CCAGATAACA
  Box motif
  Complementary to target RNA
length 129
organism Homo_sapiens
snoRNA name SNORA56
alias ACA56
chromosome ⁄ contig X
locus ⁄ host gene
organization Intronic
target RNA
modification type H/ACA
modification site 28S:U1664
accession no AJ609449 NT_167198
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved