snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA36A
sequence
TTCCAAAGTGTTGAGTTCAGTCCAGGGCAGCTTCCCTGTTCTGTTAATTAAACTTTGGG
ACATTAAAATGGGCTAAGGGAGATGATTGGGTAGAAAGTATTATTCTATTCATTTGCCTC
CCAGCCTACAAAA
  Box motif
  Complementary to target RNA
length 132
organism Homo_sapiens
snoRNA name SNORA36A
alias ACA36
chromosome ⁄ contig X
locus ⁄ host gene
organization Intronic
target RNA
modification type H/ACA
modification site 18S:U105,18S:U1244
accession no NR_002969 NT_167198
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved