snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA69
sequence
AAAGCAGGTTGCAATTACAGTGCTTCATTTTGTGGAAGTACTGCCATTATCCTGCTGAA
AGAAAAGCCGTGTTAATCATTTTTGATTTTGCCTTTATGAGGGTAAAATCATGACAGATT
GACATGGACAATT
  Box motif
  Complementary to target RNA
length 132
organism Homo_sapiens
snoRNA name SNORA69
alias U69
chromosome ⁄ contig X
locus ⁄ host gene
organization Intronic
target RNA
modification type H/ACA
modification site 18S:U36,5.8S:U69
accession no Y11163 NT_011786
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved