snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD96B
sequence
GATCCTGGTGATGACAGACGACATTGTCAGCCAATCCCCATGTGGTAGTGAGGACATGT
CCTGCAGTTCTGAAGGGATT
  Box motif
  Complementary to target RNA
length 79
organism Homo_sapiens
snoRNA name SNORD96B
alias U96b
chromosome ⁄ contig X
locus ⁄ host gene AMMECR1
organization Intronic
target RNA 5.8S rRNA
modification type C/D
modification site 5.8S:G75
accession no AY349596
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved