snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA11
sequence
GGGGTGTGCTCAGAGCAGGGGGCCCAAAGAATGGCTCCTCTGTTTACAACACACCCAAC
AGGAATCTGGGGTCATTGTGATGAGGGCGTCAAACTTGTGGCTTCCCTATGAACAAACGT
CCCCCAACACCT
  Box motif
  Complementary to target RNA
length 131
organism Homo_sapiens
snoRNA name SNORA11
alias U107
chromosome ⁄ contig X
locus ⁄ host gene MAGED2
organization Intronic
target RNA Unknown
modification type H/ACA
modification site
accession no NR_002953 NT_011630
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved