snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA11C
sequence
GGGGTGTGCTCAGAGCAGGGGGCCTGAAGAATGCTTCTTCTGTTTACAACACACCCAAT
AGGAATCTGGGGTCATTGTGACGGGGGGCACAAAACTTGTGACCTCTCTATGAACAAATG
CCCCACATGT
  Box motif
  Complementary to target RNA
length 129
organism Homo_sapiens
snoRNA name SNORA11C
alias U107d
chromosome ⁄ contig X
locus ⁄ host gene ZNF157
organization Intronic
target RNA Unknown
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved