snOPY snoRNA Orthological Gene Database
Homo_sapiens SCARNA9L1
sequence
GGGCAATGATGTAAAGGTTTTACGACTGACCTTTGTAACTATGAAGTTTTCTACACTTG
ACCTGAGCTCA
  Box motif
  Complementary to target RNA
length 70
organism Homo_sapiens
snoRNA name SCARNA9L1
alias
chromosome ⁄ contig X
locus ⁄ host gene EIF1AX
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved