snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD46.1-201
sequence
TGCTGGAGTGATGAAAAAGTATCTTCAGGTGTGGCTGTGGCCACCTTGGCCACCTGTGT
GTCACTTGCCAATGCAAGGACTTGTCATAGTTACACTGACTGTTA
  Box motif
  Complementary to target RNA
length 104
organism Homo_sapiens
snoRNA name SNORD46.1-201
alias
chromosome ⁄ contig 7
locus ⁄ host gene mono:SNORD46.1-201
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved