snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA14A
sequence
TTGCATTCTTAAACCCTCTTGGTGGCTTCCCTGTAAATGCTTCCAAGATATGAGCGAAT
GCTATAGAAATTGCAGGAAAGTCCAAAGGGCTGCGCGTCTCCTGTGGCTCAGTCTTATTT
CATACCTGCAACATCT
  Box motif
  Complementary to target RNA
length 135
organism Homo_sapiens
snoRNA name SNORA14A
alias ACA14a
chromosome ⁄ contig 7
locus ⁄ host gene POR
organization Intronic
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U966
accession no AJ609456 NT_007933
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved