snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA5B
sequence
GGCAGCCATGTCAAATTCAGTGCCTGCCCTGTCTATGGTAGGCACTGGCCCAGAAGACT
GCCACAGAAACAGTGACTCACAGGCCCTGTTACTGTGTCCCAGGCTCAGGGATAAATTTG
GTTACAGACACCA
  Box motif
  Complementary to target RNA
length 132
organism Homo_sapiens
snoRNA name SNORA5B
alias ACA5b
chromosome ⁄ contig 7
locus ⁄ host gene TBRG4
organization Intronic
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U1238,18S:U1625
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved