snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA4
sequence
TACCAAAAGTTAGCTTTTTGGGGGGCAGGTTTTTAAGTAACCTTTGCCAACTTGGGCTA
TTTGGAAGAGTAAAAGACCACACTCCACAGTGGGCTATACCACTTAGTATAGTTCGCTAC
TATTTTGTGGCCTACATG
  Box motif
  Complementary to target RNA
length 137
organism Homo_sapiens
snoRNA name SNORA4
alias ACA4
chromosome ⁄ contig 3
locus ⁄ host gene EIF4A2
organization Intronic
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U1347
accession no AJ609452 NT_005612
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved