snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA63
sequence
AAAGCAGGATTCAGACTACAATATAGCTGCTAAGTGCTGTGTTGTCGTTCCCCCTGCTT
AAAATAAAGTTGTTTCTTAACTATACCTGTCTGCTATTCTCCTGTAGCAGCCAGGGACGC
TTGGTCTCATACATGT
  Box motif
  Complementary to target RNA
length 135
organism Homo_sapiens
snoRNA name SNORA63
alias E3
chromosome ⁄ contig 3
locus ⁄ host gene EIF4A2
organization Intronic
target RNA 28S rRNA
modification type H/ACA
modification site 28S:U4390
accession no L07384 NT_005612
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved