snOPY snoRNA Orthological Gene Database
Homo_sapiens AC112907.7
sequence
ATGCAGGTACTGTTACAATACAACTGATGTGTTTTGTTGTCGTTCCCCCTGCTTAAAGC
ACTTGATGCATAACTCTGTCTACCTTCATTCCGTAGTAAGACAGAGACGCTTGGCTTCAG
ACAT
  Box motif
  Complementary to target RNA
length 123
organism Homo_sapiens
snoRNA name AC112907.7
alias
chromosome ⁄ contig 3
locus ⁄ host gene EIF4A2
organization Intronic
target RNA
modification type unknown
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved