snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA58
sequence
GGGCATACTCGTAGACCTTGCCTGACTGTGCTCATGTCCAGGCAGGGGGGACAGTGTAT
GCAAGAATAATTTGGAGTTCCTGCCAGCTCTAACCAGCTTCATCAGTGGCTGGATAAATT
GCAGGACTCTAAACATTT
  Box motif
  Complementary to target RNA
length 137
organism Homo_sapiens
snoRNA name SNORA58
alias ACA58
chromosome ⁄ contig 3
locus ⁄ host gene MRPL3
organization Intronic
target RNA 28S rRNA
modification type H/ACA
modification site 28S:U3823
accession no AJ609450 NT_005612
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved