snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA7A
sequence
GACCTCCTGGGATCGCATCTGGAGAGTGCCTAGTATTCTGCCAGCTTCGGAAAGGGAGG
GAAAGCAAGCCTGGCAGAGGCACCCATTCCATTCCCAGCTTGCTCCGTAGCTGGCGATTG
GAAGACACTCTGCGACAGTG
  Box motif
  Complementary to target RNA
length 139
organism Homo_sapiens
snoRNA name SNORA7A
alias ACA7
chromosome ⁄ contig 3
locus ⁄ host gene RPL32
organization Intronic
target RNA 28S rRNA
modification type H/ACA
modification site 28S:U1569,28S:U1779
accession no AJ609430,NT_022517
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved