snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD31
sequence
ACCACCAGTGATGAGTTGAATACTGCCCCAGTCTGATCAACATGCGTGAAAGATATTTT
CTGAGCTGTG
  Box motif
  Complementary to target RNA
length 69
organism Homo_sapiens
snoRNA name SNORD31
alias
chromosome ⁄ contig 13
locus ⁄ host gene FAM155A
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site 28S:G4166
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved