snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA31
sequence
CTGCATCCACTGATAGACCTTGAACAATTTACTGTTGTTCTTTTGGTTTGCACTAGGAT
GCAAAAGAAAGAAATCCCTGCGCTTTCTGTCTGTCTTTGTGGCGGCCCAGATTGAATTGG
GGAATACATCT
  Box motif
  Complementary to target RNA
length 130
organism Homo_sapiens
snoRNA name SNORA31
alias ACA31
chromosome ⁄ contig 13
locus ⁄ host gene
organization Intronic
target RNA
modification type H/ACA
modification site 18S:U218,28S:U3713
accession no AJ609441 NT_024524
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved