snOPY snoRNA Orthological Gene Database
Homo_sapiens AL137247.14
sequence
AAAAATTGGGATCAAAGATGCAGCCGCCTTCCCATTTAAGCAGCACAGACAGCCCAAAG
TGACAGTTTTCCTGTACAGTTACTCTTCTGTTATCTGTAACTGATCTATGACATTTTGGG
AAAAAACAGCC
  Box motif
  Complementary to target RNA
length 130
organism Homo_sapiens
snoRNA name AL137247.14
alias
chromosome ⁄ contig 13
locus ⁄ host gene N4BP2L1
organization Intronic
target RNA
modification type unknown
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved