snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA27
sequence
TACCCCCTTTTCACTTTGCCAGTTGGACTTATGTCTTTATTGGTCATTCAAGTGGGGCA
AAGGAAATATCCTTTTAAAACTCAGGCAAACTGGGTGTTTGTCTGTATCCTGTCAGAGGA
AACAAAT
  Box motif
  Complementary to target RNA
length 126
organism Homo_sapiens
snoRNA name SNORA27
alias ACA27
chromosome ⁄ contig 13
locus ⁄ host gene RPL21
organization Intronic
target RNA 28S rRNA
modification type H/ACA
modification site 28S:U3694,28S:U4522
accession no AJ609439 NT_024524
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved