snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD102
sequence
AGCTTAATGATGACTGTTTTTTTTGATTGCTTGAAGCAATGTGAAAAACACATTTCACC
GGCTCTGAAAGCT
  Box motif
  Complementary to target RNA
length 72
organism Homo_sapiens
snoRNA name SNORD102
alias U102
chromosome ⁄ contig 13
locus ⁄ host gene RPL21
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site 28S:G4020
accession no NR_002574,NT_024524
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved