snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD68
sequence
CGCGTGATGACATTCTCCGGAATCGCTGTACGGCCTTGATGAAAGCACATTTGAACCCT
TTTCCATCTGATT
  Box motif
  Complementary to target RNA
length 72
organism Homo_sapiens
snoRNA name SNORD68
alias HBII-202
chromosome ⁄ contig 16
locus ⁄ host gene RPL13
organization Intronic
target RNA 18S rRNA, 28S rRNA
modification type C/D
modification site 18S:U428,28S:A2388
accession no NR_002450,NT_010542
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved