snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA76
sequence
AAGATTCGACAGATACCCTACTGCCTCTCTTTGTGGCGGCGGGGCTCAGGCTGCAGCAC
CACAGCACTGTGTGTGTGTATAACTGGGGCCACCTGCCCCTTCCAAGTGTGGGCCTTTTA
ACCTCTATCGACAGGT
  Box motif
  Complementary to target RNA
length 135
organism Homo_sapiens
snoRNA name SNORA76
alias
chromosome ⁄ contig 16
locus ⁄ host gene
organization Intronic
target RNA
modification type H/ACA
modification site
accession no AC009163.6
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved